The Following Sequences Have Been Obtained from a Hypothetical Gene

question 53

Short Answer

The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
To properly align the three sequences so they can be used to make comparisons, a gap representing _______ nucleotides should be added to sequence D.erecta starting at position 4.

---

Definitions:

Fur Trade

The trading of animal pelts (especially beaver skins) driven by the demand for hats and other clothing items in Europe and North America.

Iroquois

The federation of six Native American nations, originally in the northeastern United States, known for their political union and significant cultural contributions.

Inland Trade

The exchange of goods and services within the interior of a country or continent, often involving the transport of products from rural areas to urban centers.

Trading Posts

Established locations where trade takes place, historically used for the exchange of goods between traders or between traders and local populations.