Examlex
The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
If we assume that each observed nucleotide change is equivalent to two nucleotide substitutions, a total of _______ substitution(s) has/have occurred between D.melanogaster and D.simulans.
Sole Proprietorship
A business structure where a single individual both owns and runs the company, often leading to simpler administrative requirements but unlimited personal liability.
Government Regulations
Laws and rules established by governmental agencies that businesses must follow to ensure compliance with standards and protections for consumers, employees, and the environment.
Chief Accounting Officer
This is an executive role responsible for overseeing the accounting operations and financial reporting of a company.
Corporation
A legal entity that is separate from its owners, who own shares in the company and have limited liability.
Q9: In the eastern United States, populations of
Q38: Some cyanobacteria that form filamentous colonies possess
Q39: Which of Koch's postulates would be especially
Q99: The biological species concept does not apply
Q153: One billion years ago, Earth was in
Q166: Males of a species of sparrow sing
Q169: The lineage species concept could be represented
Q195: Refer to the figure, which shows a
Q203: Two different species of three-spined stickleback fish
Q232: Refer to the figure showing the hypothetical