Examlex
The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
If we assume that each observed substitution is equivalent to 2 nucleotide substitutions, a total of _______ substitution(s) has/have occurred between D.melanogaster and D.simulans.
Cross-Border Flows
The movement of goods, capital, services, people, and data across international borders.
Foreign Direct Investment
Funds deployed by an individual or company from one nation into the business ventures of another country, through the initiation of business activities or the acquisition of business properties.
Subsidiaries
Companies that are owned or controlled by another larger parent company, often operating independently but reporting to the parent corporation.
Immigration
The action of coming to live permanently in a foreign country.
Q27: Four different phylogenetic trees of a group
Q51: Cattle depend on prokaryotes to perform important
Q88: Refer to the figure. <img src="https://d2lvgg3v3hfg70.cloudfront.net/TB5650/.jpg" alt="Refer
Q98: Which statement about polyploidy is true?<br>A) Autopolyploids
Q105: If allopatric speciation is the most prevalent
Q132: The most abundant organisms on Earth are
Q147: Two species of crickets have partially overlapping
Q182: According to the neutral theory of molecular
Q184: The _ of an isotope is the
Q200: What do scientists call the long-term average