The Following Sequences Have Been Obtained from a Hypothetical Gene

question 44

Short Answer

The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
If we assume that each observed nucleotide change is equivalent to two nucleotide substitutions, a total of _______ substitution(s) has/have occurred between D.melanogaster and D.simulans.

---

Definitions:

Resistance Point

In negotiations, the least favorable point at which one will accept a deal, beyond which the party would prefer to walk away from the negotiation.

Labor Negotiations

The process by which employers and unions discuss and agree on the terms of employment, including wages, working hours, and working conditions.

Costing Methodology

A systematic approach used in accounting to determine the cost associated with a product or service, for the purpose of financial reporting, decision making, or controlling.

Terms And Conditions

The rules and guidelines that govern an agreement or contract, setting out the rights and obligations of each party.