Examlex
The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
If we assume that each observed substitution is equivalent to 2 nucleotide substitutions, a total of _______ substitution(s) has/have occurred between D.melanogaster and D.simulans.
Neuron
A specific type of cell responsible for conveying nerve signals; also known as a neuron.
Brain Volume
The total volume or size of an individual's brain, which can be indicative of health, development, and certain neurological conditions.
Alcohol
A colorless volatile liquid compound, widely used as an intoxicating ingredient in drinks, and also in medicines, antiseptics, and fuels.
Functional Magnetic Resonance Imaging (fMRI)
A neuroimaging procedure that measures and maps the brain's activity by detecting changes in blood flow.
Q13: To create new antibiotics, biologists are taking
Q61: Differentiate between the following terms:<br>obligate anaerobe /
Q75: Fossil, morphological, and molecular evidence shows that
Q105: Which statement about genomes is true?<br>A) The
Q118: Which scenario describes a possible route to
Q133: The heat that drives plate tectonics is
Q189: Which of the following was not known
Q199: Evidence that meteorites collided with Earth at
Q244: Which of the following interfere(s) with the
Q250: Refer to the figure, which shows the