Examlex
Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-If we assume that a gap is equivalent to two nucleotide substitutions, how many substitutions have occurred between D. melanogaster and D. erecta?
Management Information System
An information system designed to meet the management and decision-making needs of an organization, integrating data from various departments for analysis.
Intelligence
The ability to acquire and apply knowledge and skills.
Data Warehouse
A centralized repository for data that allows an organization to store, query, and analyze large amounts of structured data from various sources.
Data Dictionary
A unified storage space for data details, including its meaning, connections with other data, source, application, and structure.
Q3: In the new population, the frequency of
Q9: Although Darwin's voyage aboard the HMS Beagle
Q10: Some oomycetes are coenocytes, which means that<br>A)
Q14: Which of the following statements about self-fertilization
Q27: Organisms that exhibit isogamy have<br>A) similar male
Q54: Which of the following characteristics is not
Q113: The bones in the wings of birds
Q117: Vascular plants first appeared during the<br>A) Cambrian.<br>B)
Q127: The antifreeze proteins found in fish that
Q146: Cattle depend on prokaryotes to perform important