Examlex
Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-How would you align the three sequences so that they could be used for making comparisons?
Cementum
A specialized calcified substance covering the root of a tooth.
Crown
The part of a tooth that is visible above the gum line, or the top portion of a dental implant that replaces the natural tooth.
Mesenteries
Folds of peritoneum that attach the intestines to the posterior abdominal wall, providing support and housing blood vessels, nerves, and lymphatic vessels.
Serosal Lining
A smooth membrane consisting of a layer of cells which secrete serous fluid, covering internal organs and cavities.
Q15: Draw a graph showing what the resulting
Q46: Which of the following kinds of data
Q46: Archaea often live in harsh environments. Those
Q55: Which of the following statements about reconstructing
Q70: Exhibiting great morphological and ecological diversity, the
Q71: Which of the following statements about Hox
Q77: Which of the following is not a
Q80: Which of the following are foregut fermenters?<br>A)
Q98: A similarity matrix gives us a measure
Q126: Paleontologists have subdivided the Cenozoic era into