Use the Following to Answer Questions

question 49

Short Answer

Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-How many substitutions have occurred between D. melanogaster and D. simulans?

---

Definitions:

Caffeine

A stimulant compound found in coffee, tea, chocolate, and various energy drinks and medications, known for boosting alertness and energy levels.

Alcohol

A psychoactive substance commonly found in beverages like beer, wine, and liquor, known for its effects on the body and mind, including potential for addiction.

African Americans

A racial or ethnic group in the United States with ancestry from the black racial groups of Africa.

Asian Americans

Individuals in the United States with origins in the far eastern, Southeast Asian, or the Indian subcontinent.