Use the Following to Answer Questions

question 9

Essay

Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-If we assume that a gap is equivalent to two nucleotide substitutions, how many substitutions have occurred between D. melanogaster and D. erecta?

---

Definitions:

Qualified Adoption Expenses

Expenses that are necessary for and directly related to the legal adoption of an eligible child, which can include adoption fees, court costs, attorney fees, traveling expenses, and other expenses directly related to the adoption.

Child Tax Credit

A tax benefit in the United States designed to help families offset the cost of raising children by reducing their tax liability on a dollar-for-dollar basis.

AGI

An income calculation that includes all taxable income and is reduced by specific deductions, instrumental in determining tax obligations.

Foreign Taxes Paid

Taxes paid to a foreign government for income earned in that foreign country, which may be creditable or deductible on a U.S. tax return.