The Restriction Enzyme SacI Has a Recognition Sequence of GAGCT^C

question 36

Multiple Choice

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?

• A) two
• B) three
• C) four
• D) five

---

Definitions:

Disturbed Sleep Pattern

A disruption in the normal sleep cycle, leading to difficulty sleeping or staying asleep.

Nicotine Withdrawal

The physical and psychological symptoms experienced by individuals when they stop using nicotine, a highly addictive substance found in tobacco.

Caffeine Intake

The amount of caffeine consumed by an individual, often measured in terms of coffee, tea, soft drinks, or energy drinks.

NREM III

The third stage of non-rapid eye movement sleep, characterized by deep sleep and the presence of delta waves in brain activity, important for physical recovery and memory consolidation.