Examlex

Solved

According to the Sequence Below (Note That the DNA Is \rightarrow

question 81

Multiple Choice

According to the sequence below (note that the DNA is written in the 5' \rightarrow 3' direction, and the gene of interest is underlined) , the BEST reverse primer to use for this gene is:  According to the sequence below (note that the DNA is written in the 5'  \rightarrow  3' direction, and the gene of interest is underlined) , the BEST reverse primer to use for this gene is:   A)  5' ATTGAATCCTTGGCT GGTGA 3'. B)  ' ATTGAATCCTTGGCT GGTGA 5'. C)  5' TCACCAGCCAAGGATTCAAT 3'. D)  3' TCACCAGCCAAGGATTCAAT 5''. E)  3' GGTGAGTCGG TTCAATTCGT 5'.


Definitions:

Weighted Moving Average

A calculated average of data points where different data points are given different weights, often used in technical analysis to smooth out price data.

Three-period

Pertains typically to a moving average or other statistical calculation considering data from three specific time periods for analysis or forecasting.

Weightage

Weightage refers to the assigned importance or value given to elements within a calculation or process, influencing the overall outcome.

Root Mean Square of Errors

A measure of the differences between values predicted by a model or an estimator and the values observed, expressing the square root of the mean of the squares of these differences.

Related Questions