The DNA Molecule Below Is Believed to Contain a Binding

question 12

Not Answered

The DNA molecule below is believed to contain a binding site for protein X. It is labeled at the 5' end of the top strand (*), then subjected to a footprinting experiment. In the idealized gel below, there is a band for every base of the labeled strand. On the DNA sequence, point out the binding site for protein X.
*(5')GGATTCTAATAAAGTAACGCGTTACGACTTGG
CCTAAGATTATTTCATTGCGCAATGCTGAACC [

---

Definitions:

Stock Dividend

A distribution of additional shares to the existing shareholders of a company, proportionate to their current shareholding.

Ratification

Ratification is the act of officially approving or confirming a decision or agreement, often used in the context of treaties, contracts, or other legal documents.

Authorized Act

An action taken by an individual or entity that has been given official permission or power to do so, typically within a legal or organizational context.

Corporation's Acceptance

The formal agreement by a corporation to abide by legal obligations or contracts, often signified through a resolution by its board of directors.