The DNA Molecule Below Is Believed to Contain a Binding

question 12

Not Answered

The DNA molecule below is believed to contain a binding site for protein X. It is labeled at the 5' end of the top strand (*), then subjected to a footprinting experiment. In the idealized gel below, there is a band for every base of the labeled strand. On the DNA sequence, point out the binding site for protein X.
*(5')GGATTCTAATAAAGTAACGCGTTACGACTTGG
CCTAAGATTATTTCATTGCGCAATGCTGAACC [

---

Definitions:

Emotionally Involved

The state of being deeply engaged with feelings or emotions, particularly in relation to a situation or cause.

Refusal-Before-Reason

A communication tactic where the denial or negative answer is given before explaining the reasons or rationale behind it.

Neutral Language

Language that avoids biases, emotions, or any form of prejudice, aiming to be objective and inclusive.

Negative News

Informing about unfavorable or disappointing information, events, or outcomes.