Examlex

Solved

This Sequence Is the 5′ End of a MRNA: 5′

question 16

Multiple Choice

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ -If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded? A) Phe Asp His B) Met Asn Gly Trp C) Met Asn Gly D) Translation will not begin. This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ -If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded? A) Phe Asp His B) Met Asn Gly Trp C) Met Asn Gly D) Translation will not begin.
-If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded?

Definitions:

Related Questions

Q5: This pedigree shows the inheritance pattern of

Q5: The pattern of embryonic expression for a

Q9: The number of people on remand is

Q9: Viruses are isolated from wild-type E.coli cells

Q14: Recessive mutations in the Sxl gene in

Q24: Currently the two main vectors for delivery

Q31: Select the statement that correctly describes the

Q31: How does the antiparallel polarity of DNA

Q32: Suppose the experiment of Meselson and Stahl

Q37: his4 trp1; his4 trp1; HIS4 TRP1; HIS4