Examlex

Solved

You Performed a Sanger Sequencing Reaction and Obtained the Following

question 29

Multiple Choice

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace.   -What is the sequence of the DNA synthesized in the sequencing reaction? A) 5' TTTGCTTTGTGAGCGGATAACAA 3' B) 3' TTTGCTTTGTGAGCGGATAACAA 5' C) 5' AAACGAAACACTCGCCTATTGTT 3' D) 3' AAACGAAACACTCGCCTATTGTT 5'
-What is the sequence of the DNA synthesized in the sequencing reaction?


Definitions:

Vicarious Liability

The liability at law of one person for the acts of another.

Negligent Misrepresentation

Negligent misstatements made by a professional to a client.

Negligent Misrepresentation

The unintentional provision of false information due to failure in exercising reasonable care or competence in communication.

Vicariously Liable

Holding one person responsible for the actions of another, especially in legal contexts where employers are responsible for their employees.

Related Questions