Examlex

Solved

Baby Frog #1 Was Born with Brown Skin Instead of the Normal

question 23

Multiple Choice

Baby frog #1 was born with brown skin instead of the normal green.DNA was collected from the baby frog and the DNA sequence of part of gene B was determined using the primer 5′ ACTCAAGCACAGGTCG 3′.What is the entire sequence of the smallest DNA fragment produced in the sequencing reaction? (See diagram for sequencing data. ) https://commons.wikimedia.org/wiki/File:DNA_sequence.svg Baby frog #1 was born with brown skin instead of the normal green.DNA was collected from the baby frog and the DNA sequence of part of gene B was determined using the primer 5′ ACTCAAGCACAGGTCG 3′.What is the entire sequence of the smallest DNA fragment produced in the sequencing reaction? (See diagram for sequencing data. )  https://commons.wikimedia.org/wiki/File:DNA_sequence.svg   A) C B) 5′ ACTCAAGCACAGGTCGC C) 5′ AGGTCGG D) 5′ CATAAATGTCCTGTTATTTGG E) 5′ CGACCTG


Definitions:

Personality Disorders

These are a group of mental health conditions characterized by enduring maladaptive patterns of behavior, cognition, and inner experience.

Behaviours

The actions or reactions of an individual, in response to external or internal stimuli, observable by oneself or others.

Categorical Classification

A method of organizing or sorting entities into distinct categories based on shared characteristics or criteria.

Medical Classification

A system used in healthcare to categorize and encode diagnoses, symptoms, and procedures, facilitating easy storage, retrieval, and analysis of health information.

Related Questions