The Sequence of Gene B from Another Baby Frog Who

question 17

Multiple Choice

The sequence of gene B from another baby frog who is homozygous for allele b² is shown.What effect does the mutation in allele b² have on the protein? 5′ AGGTCGCATAAATGTTCCTGTAATTTGG… 3′

• A)Allele b² has a frameshift mutation-a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on.
• B)Allele b² has a deletion of one nucleotide outside of the coding region and there is no effect on the protein.
• C)Allele b² has a missense mutation-a nucleotide substitution that changes one amino acid to another.
• D)Allele b² has a nonsense mutation-a nucleotide substitution that forms a stop codon.
• E)Allele b² has a silent mutation-a nucleotide substitution that does not change the protein.

---

Definitions:

Diversification

A risk management technique that mixes a wide variety of investments within a portfolio to minimize the impact of any single asset's performance.

Negatively Correlated

Refers to two variables that move in opposite directions, meaning when one variable increases, the other decreases, and vice versa.

Positively Correlated

A relationship between two variables in which they move in the same direction, meaning as one variable increases, the other also increases.

401k Retirement Accounts

Tax-advantaged retirement savings accounts offered by employers, allowing employees to save and invest a portion of their paycheck before taxes are taken out.