Examlex

Solved

You Performed a Sanger Sequencing Reaction and Obtained the Following

question 29

Multiple Choice

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace.   -What is the sequence of the DNA synthesized in the sequencing reaction? A) 5' TTTGCTTTGTGAGCGGATAACAA 3' B) 3' TTTGCTTTGTGAGCGGATAACAA 5' C) 5' AAACGAAACACTCGCCTATTGTT 3' D) 3' AAACGAAACACTCGCCTATTGTT 5'
-What is the sequence of the DNA synthesized in the sequencing reaction?


Definitions:

Mitosis

A process of cell division that results in two genetically identical daughter cells each having the same number of chromosomes as the parent nucleus.

Cytokinesis

The process during cell division in which the cytoplasm of a parent cell divides to form two daughter cells.

Nuclear Division

The process by which a nucleus divides, resulting in the segregation of the genome to distinct nuclei.

Cytoplasmic Division

The process by which a cell divides its cytoplasm to form two daughter cells, typically occurs during cytokinesis.

Related Questions