Examlex

Solved

Baby Frog #1 Was Born with Brown Skin Instead of the Normal

question 23

Multiple Choice

Baby frog #1 was born with brown skin instead of the normal green.DNA was collected from the baby frog and the DNA sequence of part of gene B was determined using the primer 5′ ACTCAAGCACAGGTCG 3′.What is the entire sequence of the smallest DNA fragment produced in the sequencing reaction? (See diagram for sequencing data. ) https://commons.wikimedia.org/wiki/File:DNA_sequence.svg Baby frog #1 was born with brown skin instead of the normal green.DNA was collected from the baby frog and the DNA sequence of part of gene B was determined using the primer 5′ ACTCAAGCACAGGTCG 3′.What is the entire sequence of the smallest DNA fragment produced in the sequencing reaction? (See diagram for sequencing data. )  https://commons.wikimedia.org/wiki/File:DNA_sequence.svg   A) C B) 5′ ACTCAAGCACAGGTCGC C) 5′ AGGTCGG D) 5′ CATAAATGTCCTGTTATTTGG E) 5′ CGACCTG


Definitions:

Frontal

Pertaining to the forehead or the frontal bone of the skull.

Cavity

An empty or hollow space within a solid structure or object.

Homeostasis

The self-regulating process by which biological systems tend to maintain stability while adjusting to conditions that are optimal for survival.

Perfusion

The process of delivering blood to a capillary bed in the tissues, crucial for delivering oxygen and nutrients, and for removing waste products.

Related Questions