Examlex
This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene.
5' ATGGGAGCTCGTTGTATTTGA 3'
3' TACCCTCGAGCAACATAAACT 5'
Aesthetic Appeal
The quality of being visually attractive or pleasing to the senses.
Site Layout
The arrangement of physical elements on a site, including buildings, pathways, and infrastructure, designed for optimal functionality and aesthetics.
Visual Design
The aspect of design focused on the aesthetic appeal and usability of products, interfaces, or environments through typography, color, images, and layout.
My eBay
My eBay is a personalized section of the eBay platform where users can manage their buying and selling activity, keep track of watched items, and view their account history.
Q1: The centromere divides a chromosome into two
Q18: An in vitro transcription system that contains
Q29: In the nematode roundworm Caenorhabditis elegans, the
Q30: Attenuation occurs in prokaryotes but has not
Q43: Histone methylation can have many different effects
Q48: Devise a strategy to prove that splicing
Q56: The contribution Charles Darwin made to biology
Q57: After electrophoresing his PCR reaction, the student
Q60: RNA-mediated repression is carried out by:<br>A) nonsense
Q63: The gene sequences contained in spot 2