Examlex

Solved

The Sequence Below Represents a Pre-MRNA

question 75

Multiple Choice

The sequence below represents a pre-mRNA. Which of the following represents the sequence of the spliced mRNA that would result from this pre-mRNA sequence? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'


Definitions:

Text Messaging

The act of sending brief, electronic messages between two or more mobile phones or fixed or portable devices over a phone network.

Social Media

Platforms and technologies that enable users to create, share, or exchange information, ideas, and content in virtual communities and networks.

Telephone

A telecommunications device designed to transmit and receive sound, primarily human voice, across distances.

Sociological Perspective

A viewpoint in sociology that looks at the behavior of individuals and how that behavior is influenced by the social forces and societal context in which they exist.

Related Questions