Use the Pre-MRNA Sequence Shown Below to Answer the Following

question 71

Essay

Use the pre-mRNA sequence shown below to answer the following questions.
mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'
a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided.
b. Predict what would happen if the G in the 5' splice site were mutated to a C.
c. We learned in this chapter that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation? How can you experimentally demonstrate that a 5' cap is important for this process?

---

Definitions:

Genetic Predisposition

An inherited increase in the likelihood of developing a particular disease based on one's genetic makeup.

Nutrients

Substances obtained from food that are essential for maintaining health and growth, including vitamins, minerals, carbohydrates, and proteins.

Fiber

Dietary material containing substances such as cellulose, which are resistant to the action of digestive enzymes and are important for bowel health.

Vitamins

Organic compounds that organisms need in small amounts for various biochemical functions and are essential for normal growth and metabolism.