Examlex
The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. What sequences of DNA would be produced if the following sequence were treated with SmaI?
AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG
Reading
The process of decoding symbols, such as letters and words, to derive meaning, a fundamental skill for acquiring knowledge and information.
Mental Set
A frame of mind involving an established way of thinking about a problem or situation, which can both aid and hinder problem-solving.
Conventional Use
The traditional or widespread accepted use or application of an object, concept, or procedure within a culture or community.
Plumber
A professional specializing in installing and maintaining systems used for potable (drinking) water, sewage, and drainage.
Q8: Vegetarians should be careful to consume a
Q15: An operator is a sequence of DNA
Q18: Scientists use existing fossils to predict what
Q20: The restriction enzyme SmaI cuts DNA between
Q23: Which of the following is not a
Q27: When a cell is performing cellular respiration,
Q33: Scientists disagree on whether evolution occurs.
Q34: The hereditary genetic material present in all
Q35: Protein is the hereditary genetic material in
Q56: DNA fingerprinting can prove guilt without fail.