Using the Following Chart,which Chain of Amino Acids Would Be

question 88

Multiple Choice

Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

• A) tyrosine-tyrosine-alanine
• B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
• C) methionine-proline-glutamate
• D) methionine-proline-glutamate-isoleucine-alanine

---

Definitions:

Settling Argument

The process of resolving a disagreement or dispute through discussion or negotiation.

Hate-motivated Killers

Individuals who commit acts of violence primarily driven by intense hatred towards a particular group or individuals based on race, religion, sexual orientation, etc.

Stalked

The act of persistently following, watching, or contacting someone in a way that is invasive, threatening, or causes fear for one's safety.

Perpetrators

Individuals who commit a harmful, illegal, or unethical act.