Examlex
The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
To properly align the three sequences so they can be used to make comparisons, a gap representing _______ nucleotides should be added to sequence D.erecta starting at position 4.
Extended Families
A family structure that goes beyond the nuclear family to include other relatives such as grandparents, aunts, uncles, and cousins.
Psychological Problems
Issues or disorders that affect an individual's mental health, influencing their thoughts, emotions, behaviors, and daily functioning.
Biological Mother
The woman who has contributed her genetic material through the egg from which a child was conceived and born.
Q2: As the amount of lateral gene transfer
Q7: The occurrence of which event(s) usually does
Q63: What is the most likely sequence of
Q69: If a group of turtle species can
Q94: Two species of grasshoppers have the same
Q184: Recall the Hillis et al.experiments that tested
Q222: Mountain ranges are ultimately the result of<br>A)
Q229: Refer to the figure <img src="https://d2lvgg3v3hfg70.cloudfront.net/TB5650/.jpg" alt="Refer
Q233: Consider a hypothetical enzyme-coding gene and sequences
Q235: Below are segments of DNA from three