How Many Amino Acids Would Be Included in the Polypeptide

question 32

Multiple Choice

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

• A) 7
• B) 8
• C) 10
• D) 13

---

Definitions:

Interest Payable

The amount of interest expense that has been incurred and is owed but has not yet been paid as of the balance sheet date.

Interest Expense

An entity's expense from acquiring funds through loans over a specific time frame.

Notes Payable

Written agreements where a borrower agrees to pay back a sum of money to a lender by a certain date.

Cash

An asset account representing currency or currency equivalents that can be accessed immediately or near-immediately.