In the Eukaryotic DNA Sequence Below, Each Highlighted Sequence Consists

question 86

Multiple Choice

In the eukaryotic DNA sequence below, each highlighted sequence consists of a simple-sequence repeat. How are the underlined regions organized relative to one another? ATTATCATCATCATCATCATTTACTAATCCTCATCATCATCATCATGGAATCTACATCATCATCATCAT

• A)as tandem repeats
• B)as dispersed repeats
• C)as inverted repeats
• D)as long terminal repeats
• E)as short terminal repeats

---

Definitions:

Different Segments

This refers to the division of a business into multiple parts for analysis, accounting, or management purposes, based on products, services, geographic locations, or customer types.

Increasing Costs

A situation where the costs of producing goods or services rise, possibly due to factors like inflation, increased labor costs, or higher material prices.

FIFO Method

A method of inventory valuation where the first items placed in inventory are the first sold, standing for "First In, First Out."

Inventory Amount

refers to the total cost or market value of all the goods and materials a company has in stock at a given time.