In the Eukaryotic DNA Sequence Below, Which Type of Repeat

question 85

Multiple Choice

In the eukaryotic DNA sequence below, which type of repeat is underlined? ATTATTTACTAATCCTCATCATCATCATCATGGAATTCATAATGCTAATGG

• A)tandem repeat
• B)dispersed repeat
• C)simple sequence repeat
• D)long terminal repeat
• E)short terminal repeat

---

Definitions:

Mental Test

A standardized assessment designed to measure a specific aspect of an individual's cognitive abilities or mental functions.

Statistical Manual

A handbook of statistical norms, procedures, and formulas used in data analysis and interpretation in various fields.

Psychological Laboratories

Facilities equipped for conducting research and experiments in psychology, studying various aspects of human behavior and cognitive processes.

Language Ability

The capacity to use complex systems of communication, particularly the human ability to do so through the use of syntax, semantics, and phonetics.