The Sequence of Gene B from Another Baby Frog Who

question 17

Multiple Choice

The sequence of gene B from another baby frog who is homozygous for allele b² is shown.What effect does the mutation in allele b² have on the protein? 5′ AGGTCGCATAAATGTTCCTGTAATTTGG… 3′

• A)Allele b² has a frameshift mutation-a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on.
• B)Allele b² has a deletion of one nucleotide outside of the coding region and there is no effect on the protein.
• C)Allele b² has a missense mutation-a nucleotide substitution that changes one amino acid to another.
• D)Allele b² has a nonsense mutation-a nucleotide substitution that forms a stop codon.
• E)Allele b² has a silent mutation-a nucleotide substitution that does not change the protein.

---

Definitions:

Cash Inflows

Money or funds entering a business from various sources like sales, investments, or financing.

Capital Budgeting

The process of evaluating and selecting long-term investments that are in line with the goal of shareholder wealth maximization, such as purchasing equipment or acquiring another business.

Discounted Cash Flow

A valuation method used to estimate the value of an investment based on its expected future cash flows, adjusted for the time value of money.

Payback Method

A capital budgeting technique that calculates the time required to recoup the cost of an investment, focusing on cash flows rather than profitability.