Examlex

Solved

You Performed a Sanger Sequencing Reaction and Obtained the Following

question 11

Multiple Choice

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace.   -What is the sequence of the template DNA used for this sequencing reaction? A) 5' TTTGCTTTGTGAGCGGATAACAA 3' B) 3' TTTGCTTTGTGAGCGGATAACAA 5' C) 5' AAACGAAACACTCGCCTATTGTT 3' D) 3' AAACGAAACACTCGCCTATTGTT 5'
-What is the sequence of the template DNA used for this sequencing reaction?


Definitions:

Motivation Enhancement

A therapeutic technique designed to increase an individual's motivation to change behavior by exploring and resolving ambivalence.

Functional Analysis

A behavioral assessment technique that seeks to understand the causes and consequences of specific behaviors.

Antecedents

Factors or conditions in a person's background or environment that precede and contribute to their patterns of behavior.

Substance Use Behaviors

Patterns or practices of using drugs, alcohol, or other substances, whether recreational or problematic.

Related Questions